sgrnas sequence Search Results


90
Promega pcr products containing the sgrna sequences
Pcr Products Containing The Sgrna Sequences, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc12043911-354-2-10?v=Promega
Average 90 stars, based on 1 article reviews
pcr products containing the sgrna sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
CustomArray Inc 20 nt target specific sgrna sequences
a , Schematic of <t>genome-scale</t> <t>CRISPRa</t> screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate <t>sgRNA</t> expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .
20 Nt Target Specific Sgrna Sequences, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc06072461-138-7-20?v=CustomArray+Inc
Average 90 stars, based on 1 article reviews
20 nt target specific sgrna sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Microsynth ag sgrna sequences
a , Schematic of <t>genome-scale</t> <t>CRISPRa</t> screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate <t>sgRNA</t> expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .
Sgrna Sequences, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pm36571986-60-0-5?v=Microsynth+ag
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma sgrna sequences fbxw7β
a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. <t>FBXW7β</t> mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
Sgrna Sequences Fbxw7β, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc07426429-97-4-8?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
sgrna sequences fbxw7β - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GenScript corporation the sgrna scaffold sequence
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
The Sgrna Scaffold Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc09048117-249-5-14?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
the sgrna scaffold sequence - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated single guide rna (sgrna) including the sequence targeting the neu2 gene
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Single Guide Rna (Sgrna) Including The Sequence Targeting The Neu2 Gene, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc08881595-32-7-20?v=ToolGen+Incorporated
Average 90 stars, based on 1 article reviews
single guide rna (sgrna) including the sequence targeting the neu2 gene - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GenScript corporation 20-nt target-specific sgrna sequences
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
20 Nt Target Specific Sgrna Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pm38493213-238-4-14?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
20-nt target-specific sgrna sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
CustomArray Inc sgrna sequences
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Sgrna Sequences, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc10635832-403-11-20?v=CustomArray+Inc
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GenScript corporation parp1 cdna orf clone cat #: ohu2551
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Parp1 Cdna Orf Clone Cat #: Ohu2551, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc07642007-499-6-17?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
parp1 cdna orf clone cat #: ohu2551 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GenScript corporation sgrna sequences
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Sgrna Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/10__1016_slash_j__bsheal__2023__04__005-62-44-50?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated sgrnas containing pam sequences
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Sgrnas Containing Pam Sequences, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc06199566-34-42-57?v=ToolGen+Incorporated
Average 90 stars, based on 1 article reviews
sgrnas containing pam sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Broad Institute Inc sgrna oligo-sequences
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Sgrna Oligo Sequences, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrnas+sequence/pmc09016078-93-0-21?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
sgrna oligo-sequences - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


a , Schematic of genome-scale CRISPRa screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate sgRNA expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .

Journal: Nature biotechnology

Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks

doi: 10.1038/nbt.4062

Figure Lengend Snippet: a , Schematic of genome-scale CRISPRa screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate sgRNA expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .

Article Snippet: For the CRISPRa library, the designed 20 nt target specific sgRNA sequences were synthesised as a pool, on microarray surfaces (CustomArray, Inc.), flanked by overhangs compatible with Gibson Assembly into the pSico based sgLenti sgRNA library vector (see for vector map).

Techniques: Selection, MANN-WHITNEY, Sampling, Generated, Expressing

a, Concept of the application of the orthogonal system for directional gene interaction studies. In the same cell, one gene is activated (CRISPRa) while another gene in knocked out (SaCas9 nuclease). b–d, Correlation of τ values from two clonal cell line replicates is shown for b, gene activation, c, gene knockout and d, all possible combinations thereof. Correlation values (r) are Pearson product-moment correlation coefficients. e , Schematic of perturbation data set from each gene pair (blue = depleted, red = enriched, NTC = non-target control sgRNA) f, Formula for calculating Ψ scores. Negative Ψ scores define interactions in which directionality could be inferred. g , To determine which of both interaction partners acts up- or downstream, τ activation values were multiplied with genetic interaction scores. Positive values indicate a downstream function, negative values an upstream function of the activated gene. h , Based on GI and Ψ scores determined by the full orthogonal interaction screen, a genetic interaction model was constructed. For positive regulators of cell fitness, nodes are shown in red and negative regulators in blue. Arrow-shaped edges indicate inferred directional interactions between nodes. Line-shaped edges symbolise genetic interactions where directionality could not be inferred. Node sizes are proportional to the degree of connectivity. In total, 2258 gene:gene combinations that passed the filter criteria were considered for the construction of the directional genetic interaction network.

Journal: Nature biotechnology

Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks

doi: 10.1038/nbt.4062

Figure Lengend Snippet: a, Concept of the application of the orthogonal system for directional gene interaction studies. In the same cell, one gene is activated (CRISPRa) while another gene in knocked out (SaCas9 nuclease). b–d, Correlation of τ values from two clonal cell line replicates is shown for b, gene activation, c, gene knockout and d, all possible combinations thereof. Correlation values (r) are Pearson product-moment correlation coefficients. e , Schematic of perturbation data set from each gene pair (blue = depleted, red = enriched, NTC = non-target control sgRNA) f, Formula for calculating Ψ scores. Negative Ψ scores define interactions in which directionality could be inferred. g , To determine which of both interaction partners acts up- or downstream, τ activation values were multiplied with genetic interaction scores. Positive values indicate a downstream function, negative values an upstream function of the activated gene. h , Based on GI and Ψ scores determined by the full orthogonal interaction screen, a genetic interaction model was constructed. For positive regulators of cell fitness, nodes are shown in red and negative regulators in blue. Arrow-shaped edges indicate inferred directional interactions between nodes. Line-shaped edges symbolise genetic interactions where directionality could not be inferred. Node sizes are proportional to the degree of connectivity. In total, 2258 gene:gene combinations that passed the filter criteria were considered for the construction of the directional genetic interaction network.

Article Snippet: For the CRISPRa library, the designed 20 nt target specific sgRNA sequences were synthesised as a pool, on microarray surfaces (CustomArray, Inc.), flanked by overhangs compatible with Gibson Assembly into the pSico based sgLenti sgRNA library vector (see for vector map).

Techniques: Activation Assay, Gene Knockout, Construct

a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. FBXW7β mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. FBXW7β mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Transfection, Cell Culture, Migration, Expressing, Western Blot

a The subcellular location of NOTCH1 receptors in CAL27 cells was assessed by immunofluorescence. The NOTCH1-FITC staining revealed that NOTCH1 protein in C1133Y-mutated cells was only localized in the cytoplasm. Costaining of NOTCH1 with ER-marker Calnexin showed strong overlapped staining in NOTCH1 C1133Y -transfected cells. FBXW7β-EGFP staining was present in the microsomal fraction together with the ER-resident protein Calnexin. Scale bar, 20 μm. b The localization of NOTCH1 or FBXW7β in cytoplasm or nucleus was assessed in 100 cells, and the percent of cells was shown. The data indicated that 79.3% of NOTCH1 C1133Y -transfected cells and 85.3% of FBXW7β-transfected cells exhibited cytoplasmic expression, but that only 54% of NOTCH1 WT -transfected cells exhibited cell cytoplasmic expression. c Overlapped staining of NOTCH1 or FBXW7β with ER-marker Calnexin was counted in NOTCH1 C1133Y and NOTCH1 WT or FBXW7β transfected cells. In all, 82.8% of NOTCH1 C1133Y -transfected cells and 91.2% of FBXW7β-transfected cells showed overlap between FITC (NOTCH1 or FBXW7β staining) and CY3 (Calnexin staining), while 50.5% of NOTCH1 WT -transfected cells showed overlapped staining between NOTCH1 and Calnexin. Data are mean ± SD. Percentages of localization were calculated from three independent experiments. ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a The subcellular location of NOTCH1 receptors in CAL27 cells was assessed by immunofluorescence. The NOTCH1-FITC staining revealed that NOTCH1 protein in C1133Y-mutated cells was only localized in the cytoplasm. Costaining of NOTCH1 with ER-marker Calnexin showed strong overlapped staining in NOTCH1 C1133Y -transfected cells. FBXW7β-EGFP staining was present in the microsomal fraction together with the ER-resident protein Calnexin. Scale bar, 20 μm. b The localization of NOTCH1 or FBXW7β in cytoplasm or nucleus was assessed in 100 cells, and the percent of cells was shown. The data indicated that 79.3% of NOTCH1 C1133Y -transfected cells and 85.3% of FBXW7β-transfected cells exhibited cytoplasmic expression, but that only 54% of NOTCH1 WT -transfected cells exhibited cell cytoplasmic expression. c Overlapped staining of NOTCH1 or FBXW7β with ER-marker Calnexin was counted in NOTCH1 C1133Y and NOTCH1 WT or FBXW7β transfected cells. In all, 82.8% of NOTCH1 C1133Y -transfected cells and 91.2% of FBXW7β-transfected cells showed overlap between FITC (NOTCH1 or FBXW7β staining) and CY3 (Calnexin staining), while 50.5% of NOTCH1 WT -transfected cells showed overlapped staining between NOTCH1 and Calnexin. Data are mean ± SD. Percentages of localization were calculated from three independent experiments. ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Immunofluorescence, Staining, Marker, Transfection, Expressing

a Fold change of FBXW7β mRNA levels in 30 paired OSCC tissues. b Fold change of FBXW7β protein expression levels in eight OSCC tissues and two nontumor tissues. c Relative FBXW7β mRNA and protein levels in five OSCC cell lines and one normal oral epithelial cell line (HOK). d qRT-PCR detection after transfection of PEGFP-N1-FBXW7α or PEGFP-N1-FBXW7β or PEGFP-N1-FBXW7γ and empty vector in HN6 and CAL27 cells. e – g Wound healing ( e ), Transwell ( f ), and CCK-8 ( g ) assays were employed to analyze the cell migration, invasion, and proliferation ability. Compared with other two subtypes, overexpression of FBXW7β significantly reduced cell growth, migration, and invasion. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Fold change of FBXW7β mRNA levels in 30 paired OSCC tissues. b Fold change of FBXW7β protein expression levels in eight OSCC tissues and two nontumor tissues. c Relative FBXW7β mRNA and protein levels in five OSCC cell lines and one normal oral epithelial cell line (HOK). d qRT-PCR detection after transfection of PEGFP-N1-FBXW7α or PEGFP-N1-FBXW7β or PEGFP-N1-FBXW7γ and empty vector in HN6 and CAL27 cells. e – g Wound healing ( e ), Transwell ( f ), and CCK-8 ( g ) assays were employed to analyze the cell migration, invasion, and proliferation ability. Compared with other two subtypes, overexpression of FBXW7β significantly reduced cell growth, migration, and invasion. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, CCK-8 Assay, Migration, Over Expression

a Flow cytometry analysis showed cell cycle arrest due to FBXW7β transfection (left panel). Proteins related to cell cycle progression were demonstrated (middle and right panel). FBXW7β overexpression resulted in the decreased expression levels of cell cycle related proteins. b FBXW7β-sgRNA dramatically increased the number of colonies (left panel) and cell growth (right panel). c , d Depleting FBXW7β potently promoted cell migration ( c ) and invasion ( d ). Data are mean ± SD from three independent experiments. e The tumors dissected from mice ( n = 6 for each group) were presented. f – h Evaluation on tumor incidence ( f ), weight ( g ), and size ( h ). All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Flow cytometry analysis showed cell cycle arrest due to FBXW7β transfection (left panel). Proteins related to cell cycle progression were demonstrated (middle and right panel). FBXW7β overexpression resulted in the decreased expression levels of cell cycle related proteins. b FBXW7β-sgRNA dramatically increased the number of colonies (left panel) and cell growth (right panel). c , d Depleting FBXW7β potently promoted cell migration ( c ) and invasion ( d ). Data are mean ± SD from three independent experiments. e The tumors dissected from mice ( n = 6 for each group) were presented. f – h Evaluation on tumor incidence ( f ), weight ( g ), and size ( h ). All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Flow Cytometry, Transfection, Over Expression, Expressing, Migration

a , b Western blotting was used to detect the expression levels of NOTCH1 and FBXW7β. The overexpression of NOTCH1 C1133Y decreased FBXW7β expression, whereas the upregulation of FBXW7β attenuated the loss of FBXW7β expression in NOTCH1 C1133Y overexpressed HN6 and CAL27 cells. c CCK-8 assay showed that upregulation of NOTCH1 C1133Y dramatically increased the cell proliferation ability in HN6 and CAL27 cells. d Transwell assay showed that the upregulation of FBXW7β significantly reduced the cell invasion in NOTCH1 C1133Y transfected cells. Data are mean ± SD from three independent experiments. e The tumors dissected from mice were presented ( n = 6 for each group). From top to bottom, each line of tumors represented: FBXW7β, NOTCH1 C1133Y , FBXW7β+ NOTCH1 C1133Y , and NC. f – h Evaluation on tumor incidence, weight, and size. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a , b Western blotting was used to detect the expression levels of NOTCH1 and FBXW7β. The overexpression of NOTCH1 C1133Y decreased FBXW7β expression, whereas the upregulation of FBXW7β attenuated the loss of FBXW7β expression in NOTCH1 C1133Y overexpressed HN6 and CAL27 cells. c CCK-8 assay showed that upregulation of NOTCH1 C1133Y dramatically increased the cell proliferation ability in HN6 and CAL27 cells. d Transwell assay showed that the upregulation of FBXW7β significantly reduced the cell invasion in NOTCH1 C1133Y transfected cells. Data are mean ± SD from three independent experiments. e The tumors dissected from mice were presented ( n = 6 for each group). From top to bottom, each line of tumors represented: FBXW7β, NOTCH1 C1133Y , FBXW7β+ NOTCH1 C1133Y , and NC. f – h Evaluation on tumor incidence, weight, and size. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Western Blot, Expressing, Over Expression, CCK-8 Assay, Transwell Assay, Transfection

a , b AKT/ERK/NFκB signaling activities were evaluated by western blot analysis in HN6 ( a ) and CAL27 cells ( b ). The gray values of images demonstrated that FBXW7β transfection decreased phosphorylation of AKT/ERK/NFκB and reversed the NOTCH1 C1133Y -induced activation of AKT/ERK/NFκB phosphorylation. c , d Overexpression of FBXW7β reversed the increased protein expression levels of EMT markers and prevented the decrease in E-cadherin and β-Catenin caused by NOTCH1 C1133Y in HN6 ( c ) and CAL27 ( d ) cells. e The expression of p-AKT, p-ERK, and p-NFκB in xenografted mice was ascertained using IHC assay on tumor sections. The percentages of positive cells were acquired from three separate images and the qualification was presented. Scale bar, 20 μm. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a , b AKT/ERK/NFκB signaling activities were evaluated by western blot analysis in HN6 ( a ) and CAL27 cells ( b ). The gray values of images demonstrated that FBXW7β transfection decreased phosphorylation of AKT/ERK/NFκB and reversed the NOTCH1 C1133Y -induced activation of AKT/ERK/NFκB phosphorylation. c , d Overexpression of FBXW7β reversed the increased protein expression levels of EMT markers and prevented the decrease in E-cadherin and β-Catenin caused by NOTCH1 C1133Y in HN6 ( c ) and CAL27 ( d ) cells. e The expression of p-AKT, p-ERK, and p-NFκB in xenografted mice was ascertained using IHC assay on tumor sections. The percentages of positive cells were acquired from three separate images and the qualification was presented. Scale bar, 20 μm. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Western Blot, Transfection, Activation Assay, Over Expression, Expressing

a HN6 and CAL27 NOTCH1 C1133Y -transfected cells were treated with MG132 (10 μM) for the indicated times, and then the levels of NOTCH1 were detected. b The cells were subjected to cycloheximide (CHX) (20 μM) exposure at the indicated times, and the protein expression levels of NOTCH1 were verified. c Co-IP between NOTCH1 C1133Y and ubiquitin in HN6 and CAL27 cells. d Co-IP experiment showed that NOTCH1 C1133Y could be co-precipitated together with FBXW7β. HN6 or CAL27 cells were transfected with NOTCH1 C1133Y , NOTCH1 WT , or NC plasmids and precipitated with NOTCH1 antibody. IgG group presented the lysates of cells transfected with NOTCH1 C1133Y were precipitated with igG, which represented the negative control. e Detection of the effects of NOTCH1 C1133Y on FBXW7β expression, either with or without CHX (20 μM) in HN6 and CAL27 cells. f Ectopic dose-dependent effect of NOTCH1 C1133Y overexpression caused a significant reduction of endogenous FBXW7β proteins. g Co-IP experiment showed MG-132 promoted the binding level of NOTCH1 and FBXW7β. The cells in NOTCH1 C1133Y groups were treated with or without proteasomal inhibitor MG132 (10 μM). Cell lysates were prepared and subjected to immunoprecipitation with anti-GFP antibody. The level of FBXW7β was detected by western blotting analysis. Data are mean ± SD from three independent experiments. *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a HN6 and CAL27 NOTCH1 C1133Y -transfected cells were treated with MG132 (10 μM) for the indicated times, and then the levels of NOTCH1 were detected. b The cells were subjected to cycloheximide (CHX) (20 μM) exposure at the indicated times, and the protein expression levels of NOTCH1 were verified. c Co-IP between NOTCH1 C1133Y and ubiquitin in HN6 and CAL27 cells. d Co-IP experiment showed that NOTCH1 C1133Y could be co-precipitated together with FBXW7β. HN6 or CAL27 cells were transfected with NOTCH1 C1133Y , NOTCH1 WT , or NC plasmids and precipitated with NOTCH1 antibody. IgG group presented the lysates of cells transfected with NOTCH1 C1133Y were precipitated with igG, which represented the negative control. e Detection of the effects of NOTCH1 C1133Y on FBXW7β expression, either with or without CHX (20 μM) in HN6 and CAL27 cells. f Ectopic dose-dependent effect of NOTCH1 C1133Y overexpression caused a significant reduction of endogenous FBXW7β proteins. g Co-IP experiment showed MG-132 promoted the binding level of NOTCH1 and FBXW7β. The cells in NOTCH1 C1133Y groups were treated with or without proteasomal inhibitor MG132 (10 μM). Cell lysates were prepared and subjected to immunoprecipitation with anti-GFP antibody. The level of FBXW7β was detected by western blotting analysis. Data are mean ± SD from three independent experiments. *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Transfection, Expressing, Co-Immunoprecipitation Assay, Negative Control, Over Expression, Binding Assay, Immunoprecipitation, Western Blot

Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the sgRNA scaffold. (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.

Journal: STAR Protocols

Article Title: Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi

doi: 10.1016/j.xpro.2022.101324

Figure Lengend Snippet: Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the sgRNA scaffold. (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.

Article Snippet: Note: In this work, the sgRNA scaffold sequence was acquired cloned into pUC19 from GenScript, but the sgRNA scaffold can be cloned in any other vector. a. Scaffold sequence: GAATTC CATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT AAGCTT .

Techniques: Knock-Out, CRISPR, In Vitro

Journal: STAR Protocols

Article Title: Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi

doi: 10.1016/j.xpro.2022.101324

Figure Lengend Snippet:

Article Snippet: Note: In this work, the sgRNA scaffold sequence was acquired cloned into pUC19 from GenScript, but the sgRNA scaffold can be cloned in any other vector. a. Scaffold sequence: GAATTC CATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT AAGCTT .

Techniques: Virus, Recombinant, Transfection, Plasmid Preparation, Staining, Expressing, Software, CRISPR, Cytometry